DNA in our genes

Rewrite Please 1. Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells   2. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.  3. Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion  (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. Link for Chapter 15: https://my.uopeople.edu/pluginfile.php/1015434/mod_page/content/6/BIOL1121-Textbook-Ch11_Ch20.pdf   1. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc   2. aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Don't use plagiarized sources. Get Your Custom Essay on
DNA in our genes
From $8/Page
Order Essay
Order NOW For A 10% Discount!
Pages (550 words)
Approximate price: -

Why Choose Us

Quality Papers

Top Writers4me provides the best top-grade academic writing services in compliance with our customers’ instructions. Have your paper written by a certified professional online college homework help writer to produce only high-quality essays with zero plagiarism.

Professional Academic Writers

You can now choose from a pool of online college homework help writers. Choose your writer and have them write the best content for you.Top Writers4me has, over the years, secured a team of the most reliable, experienced, and qualified writers. You can, therefore, trust that your assignment is in good hands.

Affordable Prices

We know that students have very limited budgets. And for that, we always strive to provide only the best, most affordable online college homework help services to our customers. Our goal is to provide top-quality assignment help services to all customers at the lowest, most affordable prices.

On-Time delivery

At Topwriters4me.com, we pay strict attention to deadlines. We recommend you to check out clients’ reviews for assurance that we will complete your assignments within the set deadlines. You can, therefore, trust that your paper will be done within and before the set deadline. Until now, we have not missed a single deadline.

100% Originality

Our Topwriters4me.com homework helper experts write only 100% original and plagiarism-free content for all of our clients. We also have a Quality Assurance Department team that goes through all work submitted by our writers multiple times. You can, therefore, rest assured that any signs of plagiarized or unoriginal content will be rejected before it reaches your portal.

Customer Support 24/7

Topwriters4me.com expert writers are always available 24/7 for customers who need assistance with using our website. You don’t have to check your watch the next time you want to have your assignment written. Our customer support is always available round the clock and ready to listen to your queries. Feel free to contact us via the Chat window or support email: support@topwriters4me.com.

Try it now!

Calculate the price of your order

We'll send you the first draft for approval by at
Total price:

How it works?

Follow these simple steps to get your paper done

Place your order

Fill in the order form and provide all details of your assignment.

Proceed with the payment

Choose the payment system that suits you most.

Receive the final file

Once your paper is ready, we will email it to you.

Our Services

For years now, Topwriters4me.com has stood as a leader in providing its customers with the best online college homework help service in the industry. And all you have to do is provide us with the details of your order. Leave everything else to us. We’ve always got you covered.


Essay Writing Services

Since we launched, Topwriters4me.com deserved the best online “college homework help status” thanks to our essay ordering, writing, and delivery process. We deliver nothing but excellence in our results. Our essay writing services include impeccable grammar, zero-plagiarism, proper structure, and conformance to guidelines.


Admission and Business Papers

Our top-quality online college homework help services guarantee that you will be accepted into your desired university. You just need to fill out your admission and business papers, and our team of online homework help workers will handle the rest. We will help you achieve and secure the best positions in your admissions forms.


Editing and Proofreading

At Topwriters4me.com, we have a skilled writing and editing team that’s dedicated to creating, editing, and restructuring for all types of papers. Our online college homework help editing and proofreading team will check, paraphrase, and correct any grammar mistakes on your paper before submitting the final document to you.


Technical Papers

At Topwriters4me.com, we pride ourselves in having writers in almost all fields, even the most technical ones. You never have to worry about your paper being too technical for our certified online college homework help writers to handle. Mycoursewriter's team of writers can handle even the most complex writers. We will match your paper to the most competent writer that we believe will handle your paper the best way possible.